Update base modification test files to use the final MM/ML tags (PR #776

)

Also add HTSlib's MM-explicit.sam, which exercises the skipped bases
modification state indicator character, and add an example MN:i field
to MM-multi.sam, to keep it in sync with HTSlib's copy.

test/SAMtags/MM-chebi.sam

@@ -1,2 +1,2 @@
 @CO	Separate m, h and N modifications
-*	0	*	0	0	*	*	0	0	AGCTCTCCAGAGTCGNACGCCATYCGCGCGCCACCA	*	Mm:Z:C+m,2,2,1,4,1;C+76792,6,7;N+n,15;	Ml:B:C,102,128,153,179,204,161,33,212
+*	0	*	0	0	*	*	0	0	AGCTCTCCAGAGTCGNACGCCATYCGCGCGCCACCA	*	MM:Z:C+m,2,2,1,4,1;C+76792,6,7;N+n,15;	ML:B:C,102,128,153,179,204,161,33,212

test/SAMtags/MM-double.sam

@@ -1,3 +1,3 @@
 @CO	Modifications called on both strands of the same record,
 @CO	including potentially at the same location simultaneously.
-*	0	*	0	0	*	*	0	0	AGGATCTCTAGCGGATCGGCGGGGGATATGCCATAT	*	Mm:Z:C+m,1,3,0;G-m,0,2,0,4;G+o,4;	Ml:B:C,128,153,179,115,141,166,192,102
+*	0	*	0	0	*	*	0	0	AGGATCTCTAGCGGATCGGCGGGGGATATGCCATAT	*	MM:Z:C+m,1,3,0;G-m,0,2,0,4;G+o,4;	ML:B:C,128,153,179,115,141,166,192,102

test/SAMtags/MM-explicit.sam

@@ -0,0 +1,27 @@
+@CO	Testing explicit vs implicit base modifications.
+@CO	This covers the case where a lack of a signal could be either
+@CO	implicitly assumed to be no-mod (default) or assumed to be
+@CO	unchecked and require an explicit statement to indicate it was
+@CO	looked at and no base modification was observed.
+@CO	
+@CO	ATCATCATTCCTACCGCTATAGCCT  r1; implicit
+@CO	  -  -   ..  -. -     --
+@CO	         Mm   M
+@CO	  -  -   ..  -. -     --
+@CO	         hH   h
+@CO	
+@CO	ATCATCATTCCTACCGCTATAGCCT  r2; explicit to a small region
+@CO	  -  -   ??  ?? ?     --
+@CO	         Mm  mM m
+@CO	  -  -   ??  ?? ?     --
+@CO	         hH  hh h
+@CO	
+@CO	ATCATCATTCCTACCGCTATAGCCT  r3; mixture
+@CO	  -  -   .   -. -     --
+@CO	         M    M
+@CO	  -  -   ??  ?? ?     --
+@CO	         hH  hh h     --
+@CO	
+r1	0	*	0	0	*	*	0	0	ATCATCATTCCTACCGCTATAGCCT	*	MM:Z:C+mh,2,0,1;	ML:B:C,200,10,50,170,160,20
+r2	0	*	0	0	*	*	0	0	ATCATCATTCCTACCGCTATAGCCT	*	MM:Z:C+mh?,2,0,0,0,0;	ML:B:C,200,10,50,170,10,5,160,20,10,5
+r3	0	*	0	0	*	*	0	0	ATCATCATTCCTACCGCTATAGCCT	*	MM:Z:C+m.,2,2;C+h?,2,0,0,0,0;	ML:B:C,200,160,10,170,5,20,5

test/SAMtags/MM-explicit.txt

@@ -0,0 +1,77 @@
+A	T
+T	A
+C	G
+A	T
+T	A
+C	G
+A	T
+T	A
+T	A
+Cm78h4	G
+Cm19h66	G
+T	A
+A	T
+C	G
+Cm62h8	G
+G	C
+C	G
+T	A
+A	T
+T	A
+A	T
+G	C
+C	G
+C	G
+T	A
+
+A	T
+T	A
+C	G
+A	T
+T	A
+C	G
+A	T
+T	A
+T	A
+Cm78h4	G
+Cm19h66	G
+T	A
+A	T
+Cm4h2	G
+Cm62h8	G
+G	C
+Cm4h2	G
+T	A
+A	T
+T	A
+A	T
+G	C
+C	G
+C	G
+T	A
+
+A	T
+T	A
+C	G
+A	T
+T	A
+C	G
+A	T
+T	A
+T	A
+Cm78h4	G
+Ch66	G
+T	A
+A	T
+Ch2	G
+Cm62h8	G
+G	C
+Ch2	G
+T	A
+A	T
+T	A
+A	T
+G	C
+C	G
+C	G
+T	A

test/SAMtags/MM-multi.sam

@@ -3,5 +3,5 @@
 @CO	r2 has them combined together, for example as produced by
 @CO	a joint basecaller which assigns probabilities to all
 @CO	trained events simultaneously.
-r1	0	*	0	0	*	*	0	0	AGCTCTCCAGAGTCGNACGCCATYCGCGCGCCACCA	*	Mm:Z:C+m,2,2,1,4,1;C+h,6,7;N+n,15,2;	Ml:B:C,128,153,179,204,230,159,6,215,240
-r2	0	*	0	0	*	*	0	0	AGCTCTCCAGAGTCGNACGCCATYCGCGCGCCACCA	*	Mm:Z:C+mh,2,2,0,0,4,1;N+n,15;	Ml:B:C,77,159,103,133,128,108,154,82,179,57,204,31,240
+r1	0	*	0	0	*	*	0	0	AGCTCTCCAGAGTCGNACGCCATYCGCGCGCCACCA	*	MM:Z:C+m,2,2,1,4,1;C+h,6,7;N+n,15,2;	ML:B:C,128,153,179,204,230,159,6,215,240	MN:i:36
+r2	0	*	0	0	*	*	0	0	AGCTCTCCAGAGTCGNACGCCATYCGCGCGCCACCA	*	MM:Z:C+mh,2,2,0,0,4,1;N+n,15;	ML:B:C,77,159,103,133,128,108,154,82,179,57,204,31,240

test/SAMtags/MM-orient.sam

@@ -1,6 +1,6 @@
 @CO	Testing mods on top and bottom strand, but also in
 @CO	original vs reverse-complemented orientation
-top-fwd	0	*	0	0	*	*	0	0	AGGATCTCTAGCGGATCGGCGGGGGATATGCCATAT	*	Mm:Z:C+m,1,3,0;	Ml:B:C,128,153,179
-top-rev	16	*	0	0	*	*	0	0	ATATGGCATATCCCCCGCCGATCCGCTAGAGATCCT	*	Mm:Z:C+m,1,3,0;	Ml:B:C,128,153,179
-bot-fwd	0	*	0	0	*	*	0	0	AGGATCTCTAGCGGATCGGCGGGGGATATGCCATAT	*	Mm:Z:G-m,0,0,4,3;	Ml:B:C,115,141,166,192
-bot-rev	16	*	0	0	*	*	0	0	ATATGGCATATCCCCCGCCGATCCGCTAGAGATCCT	*	Mm:Z:G-m,0,0,4,3;	Ml:B:C,115,141,166,192
+top-fwd	0	*	0	0	*	*	0	0	AGGATCTCTAGCGGATCGGCGGGGGATATGCCATAT	*	MM:Z:C+m,1,3,0;	ML:B:C,128,153,179
+top-rev	16	*	0	0	*	*	0	0	ATATGGCATATCCCCCGCCGATCCGCTAGAGATCCT	*	MM:Z:C+m,1,3,0;	ML:B:C,128,153,179
+bot-fwd	0	*	0	0	*	*	0	0	AGGATCTCTAGCGGATCGGCGGGGGATATGCCATAT	*	MM:Z:G-m,0,0,4,3;	ML:B:C,115,141,166,192
+bot-rev	16	*	0	0	*	*	0	0	ATATGGCATATCCCCCGCCGATCCGCTAGAGATCCT	*	MM:Z:G-m,0,0,4,3;	ML:B:C,115,141,166,192

test/SAMtags/README.md

@@ -1,15 +1,15 @@
-Mm and Ml auxiliary tags
+MM and ML auxiliary tags
 ========================
 
-The purpose of these test files is to test parsing of the Mm and Ml
-tags.  These succinct Mm and Ml tags are present in the .sam files,
+The purpose of these test files is to test parsing of the MM and ML
+tags.  These succinct MM and ML tags are present in the .sam files,
 with a more human readable expanded form in the .txt files.
 Developers should check whether their implementation is able to
 convert between the two forms.
 
 The .sam files are SAM format, but the only fields used for this
 test are the reverse-complementation flag (FLAG bit 0x10), the
-sequence, and the Mm and Ml tags.
+sequence, and the MM and ML tags.
 
 The .txt files uses one line per base, with a blank line separating
 sequences.  Each line consists of two tab-separated fields

test/SAMtags/parse_mm.pl

@@ -69,7 +69,8 @@ sub rc {
 
     print "\n" if $nseq++ > 0;
     foreach (@mods) {
-	my ($base, $strand, $types, $pos) = $_ =~ m/([A-Z])([-+])([^,]+),(.*)/;
+	my ($base, $strand, $types, $skipped_prob, $pos) =
+	    $_ =~ m/([A-Z])([-+])([a-z]+|[0-9]+)([.?]?),(.*)/;
 
 	my $i = 0; # I^{th} bosition in sequence
 	foreach my $delta (split(",", $pos)) {